Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. Dominant gain of function alleles have enlarged meristems, fasciated stems and radialized leaves. During early embryo development expression is reciprocal to target mRNAs but then changes to overlapping expression with targets. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
