Encodes a microRNA that targets one member of the F-box family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGCAUUCUGUCCACCUCC. It targets F-box protein AT1g27340.
Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG