Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU
Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair.
Computational Description
DNA LIGASE 6 (LIG6); FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, seed germination, DNA recombination, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059); BEST Arabidopsis thaliana protein match is: DNA ligase 1 (TAIR:AT1G08130.1); Has 4468 Blast hits to 4373 proteins in 907 species: Archae - 366; Bacteria - 1648; Metazoa - 644; Fungi - 681; Plants - 268; Viruses - 157; Other Eukaryotes - 704 (source: NCBI BLink).
